Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CymR in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type: Transcription factor
TF locus tag: Sca_1238
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes 16
- Operons 9
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -269
Score: 5
Sequence: TAAATACGATATATTTACTAAGGATTT
Position: -151
Score: 4.3
Sequence: TTTTACCTACATAACTACTATTTAAAA
Locus tag: Sca_0042
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP
L-cystine uptake protein tcyP

Position: -40
Score: 5.4
Sequence: TTATTCCGATGAGAATGATAAGGATAA
Locus tag: Sca_1910
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: Sca_1909
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: Sca_1908
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA
L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB
L-cystine uptake ABC transporter, permease protein TcyB
tcyC
L-cystine uptake ABC transporter, ATP-binding protein TcyC

Position: -56
Score: 4.4
Sequence: TTAATCCGAGTGATACACTAAACTTAA
Locus tag: Sca_1777
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080
putative acyl-CoA dehydrogenase

Position: -38
Score: 4.8
Sequence: TAAAACTTACTAACATTATCGGAAAAG
Locus tag: Sca_1551
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850
putative transporter for thiosulphate

Position: -110
Score: 4.7
Sequence: TTATCCCGAGTAAACTTATCAACTTAA
Locus tag: Sca_1637
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS
S-ribosylhomocysteinase

Position: -92
Score: 5.6
Sequence: TAATCCATATCAGTATAGTAGGAATAA
Locus tag: Sca_0086
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: Sca_0087
Name: mccB
Funciton: cystathionine gamma-lyase
mccA
cystathionine beta-synthase
mccB
cystathionine gamma-lyase

Position: -143
Score: 4.4
Sequence: GATATCCGATGAAATAGCTAAGATATA
Locus tag: Sca_0164
Name: cysK
Funciton: cysteine synthase
cysK
cysteine synthase

Position: -105
Score: 5.4
Sequence: TAAATCCTTGTAAACCAATAAGAATAA
Locus tag: Sca_0062
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: Sca_0063
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: Sca_0064
Name: cysC
Funciton: adenylylsulfate kinase
ytnM
conserved membrane protein YtnM
cysD
sulfate adenylyltransferase
cysC
adenylylsulfate kinase

Position: -134
Score: 5.4
Sequence: TAATTCTTAGTAAACCTATTGGAATTA
Position: -52
Score: 5.9
Sequence: TAATTCCTACTAAAAAACTAAGAATAA
Locus tag: Sca_0059
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: Sca_0060
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: Sca_0061
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
cysJ
sulfite reductase [NADPH] flavoprotein, alpha-component
cysI
sulfite reductase (NADPH) hemoprotein, beta-component
cysG
uroporphyrin-III C-methyltransferase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD