Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CymR in Staphylococcus capitis SK14

Properties
Regulator type: Transcription factor
TF locus tag: STACA0001_2394
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes 20
- Operons 9
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -57
Score: 5.1
Sequence: ATATCCTTATTATATATGTCGGAATAC
Locus tag: STACA0001_1450
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP
L-cystine uptake protein tcyP

Position: -40
Score: 6
Sequence: TTATTCCGATTAGAATAATAAGATTAA
Locus tag: STACA0001_1063
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: STACA0001_1064
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: STACA0001_1065
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA
L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB
L-cystine uptake ABC transporter, permease protein TcyB
tcyC
L-cystine uptake ABC transporter, ATP-binding protein TcyC

Position: -57
Score: 4.2
Sequence: AAAAGTCGAGTGTTAAACTAGGATTAA
Locus tag: STACA0001_1208
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080
putative acyl-CoA dehydrogenase

Position: -43
Score: 5.4
Sequence: ATATTCAGATAAGTATAATCAGAATTG
Locus tag: STACA0001_1483
Name: metN2
Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2
Locus tag: STACA0001_1484
Name: metP2
Funciton: methionine ABC transporter paralog, permease protein MetP2
Locus tag: STACA0001_1485
Name: metQ2
Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
metN2
methionine ABC transporter paralog, ATP-binding protein MetN2
metP2
methionine ABC transporter paralog, permease protein MetP2
metQ2
methionine ABC transporter paralog, substrate-binding protein MetQ2

Position: -193
Score: 5.5
Sequence: TAATTATTACTTATTCTATCGGAATAA
Locus tag: STACA0001_0838
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS
S-ribosylhomocysteinase

Position: -96
Score: 5.4
Sequence: TAATTCATACCTGATAAGTAAGAATTT
Locus tag: STACA0001_1480
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: STACA0001_1481
Name: mccB
Funciton: cystathionine gamma-lyase
mccA
cystathionine beta-synthase
mccB
cystathionine gamma-lyase

Position: -57
Score: 4.9
Sequence: TATATCCGATAGGAAAACTAAGTTTTA
Locus tag: STACA0001_2088
Name: cysK
Funciton: cysteine synthase
cysK
cysteine synthase

Position: -246
Score: 4.7
Sequence: TAAAGCATAGTATTCCGATAAGATATA
Locus tag: STACA0001_1811
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: STACA0001_1810
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: STACA0001_1809
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: STACA0001_1808
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: STACA0001_1807
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: STACA0001_1806
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: STACA0001_1805
Name: cysC
Funciton: adenylylsulfate kinase
cysJ
sulfite reductase [NADPH] flavoprotein, alpha-component
cysI
sulfite reductase (NADPH) hemoprotein, beta-component
cysG
uroporphyrin-III C-methyltransferase
sirC
Precorrin-2 dehydrogenase
ytnM
conserved membrane protein YtnM
cysD
sulfate adenylyltransferase
cysC
adenylylsulfate kinase

Position: -71
Score: 5.5
Sequence: TTATTCTGACAATTCAGATAGGAATTT
Locus tag: STACA0001_1812
Name: cysH
Funciton: phosphoadenosine phosphosulfate reductase
cysH
phosphoadenosine phosphosulfate reductase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD