Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CymR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1453
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes 21
- Operons 12
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 5.8
Sequence: TTATTCTTAGCATACTAGTCGGAATTA
Locus tag: SA0368
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP
L-cystine uptake protein tcyP

Position: -40
Score: 6.2
Sequence: TTATTCCGATTAGAATAATAAGAATAA
Locus tag: SA2202
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: SA2201
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: SA2200
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA
L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB
L-cystine uptake ABC transporter, permease protein TcyB
tcyC
L-cystine uptake ABC transporter, ATP-binding protein TcyC

Position: -41
Score: 6
Sequence: TAATTCCTATTAAAATAGTAGGGATTA
Locus tag: SA0166
Name: ssuB
Funciton: sulfonate ABC transporter, ATPase component
Locus tag: SA0167
Name: ssuA
Funciton: sulfonate ABC transporter, substrate-binding component
Locus tag: SA0168
Name: ssuC
Funciton: sulfonate ABC transporter, permease component
Locus tag: SA0169
Name: SA0169
Funciton: putative acyl-CoA dehydrogenase
ssuB
sulfonate ABC transporter, ATPase component
ssuA
sulfonate ABC transporter, substrate-binding component
ssuC
sulfonate ABC transporter, permease component
SA0169
putative acyl-CoA dehydrogenase

Position: -62
Score: 4.6
Sequence: TAAAGTCGAGTGTTAAACTAGGAATAA
Locus tag: SA2080
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080
putative acyl-CoA dehydrogenase

Position: -40
Score: 5.2
Sequence: TAATACATACTAAACTTATCGGAAATG
Locus tag: SA1850
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850
putative transporter for thiosulphate

Position: -77
Score: 4.8
Sequence: TAATCTTGAGTAGATTACTATGATATA
Locus tag: SA0198
Name: SA0198
Funciton: oligopeptide transport ATP-binding protein
SA0198
oligopeptide transport ATP-binding protein

Position: -59
Score: 4.9
Sequence: GTAATCCGATAAGAATTATAGTAATAT
Locus tag: SA0165
Name: SA0165
Funciton: hypothetical protein
SA0165
hypothetical protein

Position: -42
Score: 5.8
Sequence: TTATTCCTAGTGGATTAATAAGAATTT
Locus tag: SA0420
Name: metN2
Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2
Locus tag: SA0421
Name: metP2
Funciton: methionine ABC transporter paralog, permease protein MetP2
Locus tag: SA0422
Name: metQ2
Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
metN2
methionine ABC transporter paralog, ATP-binding protein MetN2
metP2
methionine ABC transporter paralog, permease protein MetP2
metQ2
methionine ABC transporter paralog, substrate-binding protein MetQ2

Position: -244
Score: 4.8
Sequence: GAATTATTACTTATTCTATCGGTTTTA
Locus tag: SA1936
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS
S-ribosylhomocysteinase

Position: -88
Score: 5.8
Sequence: TAATTCTTATCTGAAAAGTAAGAATTA
Locus tag: SA0418
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: SA0419
Name: mccB
Funciton: cystathionine gamma-lyase
mccA
cystathionine beta-synthase
mccB
cystathionine gamma-lyase

Position: -55
Score: 5.1
Sequence: TATATCCGATAAATAAACTAAGATTTC
Locus tag: SA0471
Name: cysK
Funciton: cysteine synthase
cysK
cysteine synthase

Position: -257
Score: 4.7
Sequence: TAATAAATAGTAAATAAATAAAAAATA
Locus tag: SA2413
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: SA2412
Name: sirC
Funciton: Precorrin-2 dehydrogenase
cysJ
sulfite reductase [NADPH] flavoprotein, alpha-component
sirC
Precorrin-2 dehydrogenase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD