Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NanR in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type: Transcription factor
TF locus tag: Blon_0642
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Sialic acid utilization
Effector: Sialic acid
Regulog: NanR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -200
Score: 6.5
Sequence: ATAAGACGTCTGACGTCTTAT
Position: -102
Score: 5
Sequence: ATCAGACGTCTGATGTTTCCC
Locus tag: Blon_0646
Name: nanH
Funciton: Sialidase (EC 3.2.1.18)
nanH
Sialidase (EC 3.2.1.18)

Position: -73
Score: 5.2
Sequence: GATATACATCAGATGTCTGAT
Position: -66
Score: 5.4
Sequence: ATCAGATGTCTGATGTATAAT
Locus tag: Blon_0643
Name: SSF51658
Funciton: Xylose isomerase-like, TIM barrel domain
Locus tag: Blon_0644
Name: nanK
Funciton: N-acetylmannosamine kinase (EC 2.7.1.60)
Locus tag: Blon_0645
Name: nanE
Funciton: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9)
SSF51658
Xylose isomerase-like, TIM barrel domain
nanK
N-acetylmannosamine kinase (EC 2.7.1.60)
nanE
N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9)

Position: -250
Score: 4.9
Sequence: GGGAAACATCAGACGTCTGAT
Position: -152
Score: 6.6
Sequence: ATAAGACGTCAGACGTCTTAT
Locus tag: Blon_0647
Name: nanB
Funciton: Predicted sialic acid ABC transporter, solute binding component
Locus tag: Blon_0648
Name: nanC
Funciton: Predicted sialic acid ABC transporter, permease component
Locus tag: Blon_0649
Name: nanD
Funciton: Predicted sialic acid ABC transporter, permease component and ATP-binding component
Locus tag: Blon_0650
Name: nanF
Funciton: Predicted sialic acid ABC transporter, ATP binding component
Locus tag: Blon_0651
Name: nanA
Funciton: N-acetylneuraminate lyase (EC 2.5.1.56)
nanB
Predicted sialic acid ABC transporter, solute binding component
nanC
Predicted sialic acid ABC transporter, permease component
nanD
Predicted sialic acid ABC transporter, permease component and ATP-binding component
nanF
Predicted sialic acid ABC transporter, ATP binding component
nanA
N-acetylneuraminate lyase (EC 2.5.1.56)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD