Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GlxR in Bifidobacterium longum NCC2705

Properties
Regulator type: Transcription factor
TF locus tag: BL0846
Regulator family: LacI
Regulation mode:
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: GlxR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -158
Score: 6.9
Sequence: AACGGTAAACGTTTTCCGTA
Locus tag: BL0846
Name: glxR
Funciton: Transcriptional regulator of glycerate kinase, LacI family
glxR
Transcriptional regulator of glycerate kinase, LacI family

Position: 42
Score: 6.9
Sequence: TACGGAAAACGTTTACCGTT
Locus tag: BL0845
Name: glxK
Funciton: Glycerate kinase (EC 2.7.1.31)
glxK
Glycerate kinase (EC 2.7.1.31)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD