Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type: Transcription factor
TF locus tag: SSP2384, SSPP121
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Regulog: ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes 11
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -56
Score: 5.4
Sequence: AATATAGACACCAATCTATATA
Position: -40
Score: 6.5
Sequence: TATATAGATGTTAGTCTATGTA
Locus tag: SSP2384
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SSP2383
Name: arsB
Funciton: arsenic efflux pump protein
arsR
arsenical resistance operon repressor
arsB
arsenic efflux pump protein

Position: -65
Score: 5.8
Sequence: TACATAGACACTAATCTATATA
Position: -49
Score: 6.1
Sequence: TATATAGATGTTAATCTATGGT
Locus tag: SSPP119
Name: arsD
Funciton: arsenical resistance operon trans-acting ArsD
Locus tag: SSPP118
Name: arsA
Funciton: arsenite-transporting ATPase
Locus tag: SSPP117
Name: SSPP117
Funciton: putative dehydrogenase
Locus tag: SSPP116
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SSPP115
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SSPP114
Name: arsC
Funciton: arsenate reductase
arsD
arsenical resistance operon trans-acting ArsD
arsA
arsenite-transporting ATPase
SSPP117
putative dehydrogenase
arsR
arsenical resistance operon repressor
arsB
arsenic efflux pump protein
arsC
arsenate reductase

Position: -257
Score: 6.1
Sequence: ACCATAGATTAACATCTATATA
Position: -241
Score: 5.8
Sequence: TATATAGATTAGTGTCTATGTA
Locus tag: SSPP120
Name: SH0113
Funciton: hypothetical protein
Locus tag: SSPP121
Name: arsR3
Funciton: arsenical resistance operon repressor-like protein
Locus tag: SSPP122
Name: SE0140
Funciton: putative permease
SH0113
hypothetical protein
arsR3
arsenical resistance operon repressor-like protein
SE0140
putative permease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD