Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type: Transcription factor
TF locus tag: SH0103, SH0110, SH0114
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Regulog: ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes 12
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 6.8
Sequence: TATATAGATGATAATCTATAAT
Locus tag: SH0103
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SH0102
Name: arsB
Funciton: arsenical pump membrane protein
Locus tag: SH0101
Name: arsC
Funciton: arsenate reductase
arsR
arsenical resistance operon repressor
arsB
arsenical pump membrane protein
arsC
arsenate reductase

Position: -213
Score: 5.3
Sequence: AATATAAATCAATATCTATATT
Position: -65
Score: 5.1
Sequence: AACATAGACACCAATCTATATA
Position: -49
Score: 6.7
Sequence: TATATAGATGTTAATCTATAAT
Locus tag: SH0112
Name: arsD
Funciton: arsenical resistance operon trans-acting ArsD
Locus tag: SH0111
Name: arsA
Funciton: arsenite-transporting ATPase
Locus tag: SH0110
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SH0109
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SH0108
Name: arsC
Funciton: arsenate reductase
arsD
arsenical resistance operon trans-acting ArsD
arsA
arsenite-transporting ATPase
arsR
arsenical resistance operon repressor
arsB
arsenic efflux pump protein
arsC
arsenate reductase

Position: -254
Score: 6.7
Sequence: ATTATAGATTAACATCTATATA
Position: -238
Score: 5.1
Sequence: TATATAGATTGGTGTCTATGTT
Position: -90
Score: 5.3
Sequence: AATATAGATATTGATTTATATT
Locus tag: SH0113
Name: SH0113
Funciton: hypothetical protein
Locus tag: SH0114
Name: arsR3
Funciton: hypothetical protein
Locus tag: SH0115
Name: SE0140
Funciton: putative permease
Locus tag: SH0116
Name: SE0141
Funciton: hypothetical protein
SH0113
hypothetical protein
arsR3
hypothetical protein
SE0140
putative permease
SE0141
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD