Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type: Transcription factor
TF locus tag: SE0136, SE0139
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Regulog: ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -493
Score: 6.4
Sequence: ATTATAGACTAACATCTATATA
Position: -477
Score: 5.9
Sequence: TATATAGATTAATGTCTATGTT
Position: -332
Score: 4.8
Sequence: AATATATATATTGATTTATATT
Locus tag: SE0139
Name: arsR3
Funciton: arsenical resistance operon repressor-like protein
Locus tag: SE0140
Name: SE0140
Funciton: putative permease
Locus tag: SE0141
Name: SE0141
Funciton: hypothetical protein
arsR3
arsenical resistance operon repressor-like protein
SE0140
putative permease
SE0141
hypothetical protein

Position: -65
Score: 5.9
Sequence: AACATAGACATTAATCTATATA
Position: -49
Score: 6.4
Sequence: TATATAGATGTTAGTCTATAAT
Locus tag: SE0138
Name: arsD
Funciton: arsenical resistance operon trans-acting ArsD
Locus tag: SE0137
Name: arsA
Funciton: arsenite-transporting ATPase
Locus tag: SE0136
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SE0135
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SE0134
Name: arsC
Funciton: arsenate reductase
arsD
arsenical resistance operon trans-acting ArsD
arsA
arsenite-transporting ATPase
arsR
arsenical resistance operon repressor
arsB
arsenic efflux pump protein
arsC
arsenate reductase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD