Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Staphylococcus capitis SK14

Properties
Regulator type: Transcription factor
TF locus tag: STACA0001_1318
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Regulog: ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 6
Sequence: TATATAGATATTTGTCTATATA
Position: -42
Score: 6.8
Sequence: TATATAGATGATAATCTATAAT
Locus tag: STACA0001_1318
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: STACA0001_1319
Name: arsB
Funciton: arsenical pump membrane protein
Locus tag: STACA0001_1320
Name: arsC
Funciton: arsenate reductase
arsR
arsenical resistance operon repressor
arsB
arsenical pump membrane protein
arsC
arsenate reductase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD