Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SAP016, SA1591
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Regulog: ArsR - Staphylococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -56
Score: 6.2
Sequence: AATATAGACATTCATCTATATA
Position: -40
Score: 6.9
Sequence: TATATAGATGATAATCTATTTA
Locus tag: SA1591
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SA1592
Name: arsB
Funciton: arsenic efflux pump protein
arsR
arsenical resistance operon repressor
arsB
arsenic efflux pump protein

Position: -57
Score: 6.1
Sequence: AACATAGACAATAATCTATATA
Position: -41
Score: 6.7
Sequence: TATATAGATGTTAATCTATTTA
Locus tag: SAP016
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SAP017
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SAP018
Name: arsC
Funciton: arsenate reductase
arsR
arsenical resistance operon repressor
arsB
arsenic efflux pump protein
arsC
arsenate reductase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD