Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraQ in Bifidobacterium longum NCC2705

Properties
Regulator type: Transcription factor
TF locus tag: BL0275
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 19
- Operons 13
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 5.5
Sequence: CAGTGTGAGCGCTAACGCAA
Locus tag: BL0275
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ
Transcriptional regulator of central carbohydrate metabolism, LacI family

Position: -40
Score: 6.1
Sequence: CAATGTGAGCGCTCACAACA
Locus tag: BL0988
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk
Pyruvate kinase (EC 2.7.1.40)

Position: -110
Score: 6.1
Sequence: CATTGTGAGCGCTCACATCT
Locus tag: BL1570
Name: malQ1
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malQ1
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)

Position: -45
Score: 5
Sequence: AGTTGTGAACGTTAACATGG
Locus tag: BL1533
Name: null
Funciton: Biotin-protein ligase (EC 6.3.4.15)
Biotin-protein ligase (EC 6.3.4.15)

Position: -123
Score: 5
Sequence: CCATGTTAACGTTCACAACT
Locus tag: BL1532
Name: null
Funciton: hypothetical protein
Locus tag: BL1531
Name: null
Funciton: Regulator of polyketide synthase expression
hypothetical protein
Regulator of polyketide synthase expression

Position: -246
Score: 5.4
Sequence: ATATGTTAGCGCTCTCATAA
Locus tag: BL0141
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malE
Maltose/maltodextrin ABC transporter, substrate binding protein

Position: -147
Score: 5.3
Sequence: CTATGAGAGCGCTCACAACC
Locus tag: BL0999
Name: glgB
Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
Locus tag: BL1000
Name: null
Funciton: response regulator of two-component system
Locus tag: BL1001
Name: null
Funciton: histidine kinase sensor of two-component system
glgB
1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
response regulator of two-component system
histidine kinase sensor of two-component system

Position: -43
Score: 5.4
Sequence: GATTGTGAGCGATAACAATT
Locus tag: BL1359
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM
Aldose 1-epimerase (EC 5.1.3.3)

Position: -156
Score: 5.6
Sequence: CACTGTGAACGCTAACAGAA
Locus tag: BL0716
Name: tkt
Funciton: Transketolase (EC 2.2.1.1)
Locus tag: BL0715
Name: tal
Funciton: Transaldolase (EC 2.2.1.2)
tkt
Transketolase (EC 2.2.1.1)
tal
Transaldolase (EC 2.2.1.2)

Position: -160
Score: 5.7
Sequence: ATTCGTGAGCGCTAACAACC
Locus tag: BL1308
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh
L-lactate dehydrogenase (EC 1.1.1.27)

Position: -108
Score: 5.6
Sequence: CATTGTGAGCGCTAACGCTA
Locus tag: BL1022
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno
Enolase (EC 4.2.1.11)

Position: -155
Score: 6.2
Sequence: AATTGTGAGCGCTCACAGAA
Locus tag: BL1363
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)

Position: -70
Score: 5.8
Sequence: AATTGTGAGCGCTAACACCC
Locus tag: BL0274
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BL0273
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BL0272
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araB
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araA
L-arabinose isomerase (EC 5.3.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD