Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraQ in Bifidobacterium gallicum DSM 20093

Properties
Regulator type: Transcription factor
TF locus tag: BIFGAL_00652
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -125
Score: 5.5
Sequence: CTATGTTAACGCTAACAACA
Locus tag: BIFGAL_00353
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk
Pyruvate kinase (EC 2.7.1.40)

Position: -2
Score: 5.7
Sequence: AAATGTTAGCGCTAACATAC
Locus tag: BIFGAL_00651
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BIFGAL_00650
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BIFGAL_00649
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araB
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -104
Score: 4.5
Sequence: ACATGTGAACACTCACTGCA
Locus tag: BIFGAL_01223
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno
Enolase (EC 4.2.1.11)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD