Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraQ in Bifidobacterium dentium Bd1

Properties
Regulator type: Transcription factor
TF locus tag: BDP_1926
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 12
- Operons 9
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -106
Score: 5.5
Sequence: GTATGTGAGCGTTCACATGA
Locus tag: BDP_0870
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno
Enolase (EC 4.2.1.11)

Position: -75
Score: 5.1
Sequence: GCCTGTTAGCGCTAACTGAA
Locus tag: BDP_1926
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ
Transcriptional regulator of central carbohydrate metabolism, LacI family

Position: -81
Score: 5.3
Sequence: AATAGTGAGCGTTAACAGTG
Position: -68
Score: 5.5
Sequence: AACAGTGAGCGCTAACATTC
Locus tag: BDP_1924
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BDP_1923
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BDP_1922
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araB
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -49
Score: 5.5
Sequence: TTGCGTGAACGCTCACAACA
Locus tag: BDP_0569
Name: maa
Funciton: Maltose O-acetyltransferase (EC 2.3.1.79)
maa
Maltose O-acetyltransferase (EC 2.3.1.79)

Position: -56
Score: 4.8
Sequence: GACCGTTAGCGGTAACAACC
Locus tag: BDP_1518
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM
Aldose 1-epimerase (EC 5.1.3.3)

Position: -157
Score: 5.7
Sequence: CATTGTGAACGCTAACAGAA
Locus tag: BDP_1145
Name: tkt
Funciton: Transketolase (EC 2.2.1.1)
Locus tag: BDP_1144
Name: tal
Funciton: Transaldolase (EC 2.2.1.2)
tkt
Transketolase (EC 2.2.1.1)
tal
Transaldolase (EC 2.2.1.2)

Position: -156
Score: 5.5
Sequence: CATTGTGAGCGTTCACGGAA
Locus tag: BDP_1514
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)

Position: -162
Score: 6.1
Sequence: GTTTGTGAGCGCTCACATCA
Locus tag: BDP_1558
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh
L-lactate dehydrogenase (EC 1.1.1.27)

Position: -126
Score: 6.2
Sequence: AAATGTGAGCGCTCACAACA
Locus tag: BDP_0904
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk
Pyruvate kinase (EC 2.7.1.40)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD