Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraQ in Bifidobacterium breve DSM 20213

Properties
Regulator type: Transcription factor
TF locus tag: BIFBRE_02212
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 15
- Operons 11
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -155
Score: 6.2
Sequence: CAATGTGAGCGCTCACAAAA
Locus tag: BIFBRE_01690
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)

Position: -77
Score: 6
Sequence: CAGTGTGAGCGCTCACAACA
Locus tag: BIFBRE_01051
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk
Pyruvate kinase (EC 2.7.1.40)

Position: -107
Score: 5.2
Sequence: ACGTGTGAGCGTTCACACCG
Locus tag: BIFBRE_00166
Name: null
Funciton: Biotin-protein ligase (EC 6.3.4.15)
Biotin-protein ligase (EC 6.3.4.15)

Position: -213
Score: 5.2
Sequence: CGGTGTGAACGCTCACACGT
Locus tag: BIFBRE_00165
Name: null
Funciton: hypothetical protein
Locus tag: BIFBRE_00164
Name: null
Funciton: Regulator of polyketide synthase expression
hypothetical protein
Regulator of polyketide synthase expression

Position: -229
Score: 4.9
Sequence: GCATGTTAGCGCTCTCATTG
Locus tag: BIFBRE_00012
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malE
Maltose/maltodextrin ABC transporter, substrate binding protein

Position: -108
Score: 5.4
Sequence: CAATGAGAGCGCTCACAATC
Locus tag: BIFBRE_01039
Name: glgB
Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
Locus tag: BIFBRE_01038
Name: null
Funciton: response regulator of two-component system
Locus tag: BIFBRE_01037
Name: null
Funciton: histidine kinase sensor of two-component system
glgB
1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
response regulator of two-component system
histidine kinase sensor of two-component system

Position: -44
Score: 4.9
Sequence: GATTGCGAGCGGTAACAATA
Locus tag: BIFBRE_01694
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM
Aldose 1-epimerase (EC 5.1.3.3)

Position: -156
Score: 5.8
Sequence: AATTGTGAACGCTAACAGAA
Locus tag: BIFBRE_01332
Name: tkt
Funciton: Transketolase (EC 2.2.1.1)
Locus tag: BIFBRE_01331
Name: tal
Funciton: Transaldolase (EC 2.2.1.2)
tkt
Transketolase (EC 2.2.1.1)
tal
Transaldolase (EC 2.2.1.2)

Position: -146
Score: 5.4
Sequence: CAATGTGAGCGCTCACGCGA
Locus tag: BIFBRE_02212
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ
Transcriptional regulator of central carbohydrate metabolism, LacI family

Position: -108
Score: 6.1
Sequence: CATTGTGAGCGCTCACATCA
Locus tag: BIFBRE_01016
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno
Enolase (EC 4.2.1.11)

Position: -160
Score: 5.9
Sequence: GGCTGTGAGCGCTAACAACT
Locus tag: BIFBRE_01807
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh
L-lactate dehydrogenase (EC 1.1.1.27)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD