Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraQ in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type: Transcription factor
TF locus tag: BbifN4_010100001372
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 13
- Operons 9
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -155
Score: 5.3
Sequence: ATTTGTTAGCGTTAACGGAA
Locus tag: BbifN4_010100002494
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)

Position: -163
Score: 5.8
Sequence: GTCTGTGAGCGTTCACAACA
Locus tag: BbifN4_010100002254
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh
L-lactate dehydrogenase (EC 1.1.1.27)

Position: -44
Score: 4.5
Sequence: GATAGCGAGCGGTAACAATA
Locus tag: BbifN4_010100002474
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM
Aldose 1-epimerase (EC 5.1.3.3)

Position: -131
Score: 6.1
Sequence: AGATGTGAGCGCTCACAACA
Locus tag: BbifN4_010100003349
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk
Pyruvate kinase (EC 2.7.1.40)

Position: -159
Score: 5.8
Sequence: ACTTGTGAGCGCTAACATAA
Locus tag: BbifN4_010100004774
Name: tkt
Funciton: Transketolase (EC 2.2.1.1)
Locus tag: BbifN4_010100004779
Name: tal
Funciton: Transaldolase (EC 2.2.1.2)
tkt
Transketolase (EC 2.2.1.1)
tal
Transaldolase (EC 2.2.1.2)

Position: -122
Score: 5.4
Sequence: ATCTGTGAGCGCTCACGCGT
Locus tag: BbifN4_010100001372
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ
Transcriptional regulator of central carbohydrate metabolism, LacI family

Position: -105
Score: 5.3
Sequence: GAATGTTAGCGCTCATATTA
Locus tag: BbifN4_010100003174
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno
Enolase (EC 4.2.1.11)

Position: -238
Score: 5.5
Sequence: ATATGTGAGCGCTCCCAATT
Locus tag: BbifN4_010100001337
Name: gatC
Funciton: putative PTS system, galactitol-specific IIC component
Locus tag: BbifN4_010100001342
Name: lyxK
Funciton: L-xylulose kinase (EC 2.7.1.-)
Locus tag: BbifN4_010100001347
Name: sgaU
Funciton: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
Locus tag: BbifN4_010100001352
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
gatC
putative PTS system, galactitol-specific IIC component
lyxK
L-xylulose kinase (EC 2.7.1.-)
sgaU
L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)

Position: -130
Score: 5.5
Sequence: AATTGGGAGCGCTCACATAT
Locus tag: BbifN4_010100001332
Name: sgaR
Funciton: Putative transcriptional regulator of L-ascorbate utilization, SorC family
sgaR
Putative transcriptional regulator of L-ascorbate utilization, SorC family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD