Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraQ in Bifidobacterium angulatum DSM 20098

Properties
Regulator type: Transcription factor
TF locus tag: BIFANG_00190
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 8
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -51
Score: 5.1
Sequence: ATGTGTTAGCGGTAACAACC
Locus tag: BIFANG_01641
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM
Aldose 1-epimerase (EC 5.1.3.3)

Position: -166
Score: 4.7
Sequence: AAACGAGAACGCTAACAGAA
Locus tag: BIFANG_01436
Name: tkt
Funciton: Transketolase (EC 2.2.1.1)
tkt
Transketolase (EC 2.2.1.1)

Position: -347
Score: 5.3
Sequence: TTTTGAGAGCGTTCACATCA
Position: -176
Score: 5.4
Sequence: AAATGTGAGCGATAACATTT
Locus tag: BIFANG_00188
Name: araE
Funciton: L-arabinose-proton symporter
Locus tag: BIFANG_00187
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BIFANG_00186
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BIFANG_00185
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araE
L-arabinose-proton symporter
araB
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -102
Score: 4.7
Sequence: CGATGTGAGCGCTGCCAGTG
Locus tag: BIFANG_00987
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh
L-lactate dehydrogenase (EC 1.1.1.27)

Position: -131
Score: 6.1
Sequence: AATTGTTAGCGCTCACATAA
Locus tag: BIFANG_01141
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk
Pyruvate kinase (EC 2.7.1.40)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD