Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraQ in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type: Transcription factor
TF locus tag: BAD_1413
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 14
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -106
Score: 5.3
Sequence: GAGTGTGAGCGTTCACATGG
Locus tag: BAD_0645
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno
Enolase (EC 4.2.1.11)

Position: -23
Score: 6.2
Sequence: GTATGTGAGCGCTCACAAAA
Locus tag: BAD_1117
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh
L-lactate dehydrogenase (EC 1.1.1.27)

Position: -156
Score: 5.1
Sequence: GCATGTGAGCGTTCACTGAA
Locus tag: BAD_1079
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)

Position: -75
Score: 5.4
Sequence: GGTTGTTAGCGCTAACTGAA
Locus tag: BAD_1413
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ
Transcriptional regulator of central carbohydrate metabolism, LacI family

Position: -82
Score: 5.3
Sequence: AATAGTGAGCGTTAACAGTG
Position: -69
Score: 5.5
Sequence: AACAGTGAGCGCTAACATTC
Locus tag: BAD_1412
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BAD_1411
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BAD_1410
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araB
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -49
Score: 5.5
Sequence: GATTGTGAGCGTTAACAAGA
Locus tag: BAD_1529
Name: PF07944
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: BAD_1528
Name: aga
Funciton: Alpha-galactosidase (EC 3.2.1.22)
PF07944
Putative glycosyl hydrolase of unknown function (DUF1680)
aga
Alpha-galactosidase (EC 3.2.1.22)

Position: -20
Score: 5.4
Sequence: TGGTGTGAGCGTTCACTATA
Locus tag: BAD_0431
Name: maa
Funciton: Maltose O-acetyltransferase (EC 2.3.1.79)
maa
Maltose O-acetyltransferase (EC 2.3.1.79)

Position: -57
Score: 5
Sequence: CATCGTGAGCGGTAACATAG
Locus tag: BAD_1082
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM
Aldose 1-epimerase (EC 5.1.3.3)

Position: -156
Score: 6.1
Sequence: AATTGTGAGCGCTAACAGCA
Locus tag: BAD_0829
Name: tkt
Funciton: Transketolase (EC 2.2.1.1)
Locus tag: BAD_0830
Name: tal
Funciton: Transaldolase (EC 2.2.1.2)
tkt
Transketolase (EC 2.2.1.1)
tal
Transaldolase (EC 2.2.1.2)

Position: -51
Score: 6.3
Sequence: AATTGTGAGCGCTCACAACA
Locus tag: BAD_0678
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk
Pyruvate kinase (EC 2.7.1.40)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD