Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR1 in Gardnerella vaginalis 409-05

Properties
Regulator type: Transcription factor
TF locus tag: HMPREF0424_1339
Regulator family: LacI
Regulation mode:
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR1 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -281
Score: 7.1
Sequence: TTGCGGTAACGTTACCGCAT
Position: -237
Score: 5.1
Sequence: TTGTGGGAACGTTATCTCAA
Locus tag: HMPREF0424_1339
Name: rbsR1
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: HMPREF0424_1338
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: HMPREF0424_1337
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: HMPREF0424_1336
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: HMPREF0424_1335
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: HMPREF0424_1334
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsR1
Transcriptional repressor of ribose utilization, LacI family
rbsA
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsK
Ribokinase (EC 2.7.1.15)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD