Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR1 in Bifidobacterium dentium Bd1

Properties
Regulator type: Transcription factor
TF locus tag: BDP_0171
Regulator family: LacI
Regulation mode:
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR1 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -41
Score: 6.9
Sequence: GTGCGGTAACGTTGCCGCAC
Locus tag: BDP_0172
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: BDP_0173
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: BDP_0174
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: BDP_0175
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)

Position: -232
Score: 6.6
Sequence: TTGTGGTAACGTTACCGCAT
Position: -187
Score: 7
Sequence: ATGAGGTAACGTTACCGCAT
Locus tag: BDP_0171
Name: rbsR1
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsR1
Transcriptional repressor of ribose utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD