Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HxlR in Bifidobacterium angulatum DSM 20098

Properties
Regulator type: Transcription factor
TF locus tag: BIFANG_01236
Regulator family: LacI
Regulation mode:
Biological process: Hexulose metabolism
Effector:
Regulog: HxlR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -131
Score: 5.5
Sequence: GTAGTTAACCGGTACACATG
Position: -96
Score: 5.6
Sequence: GTTGTTAACCGATAAACGTA
Position: -83
Score: 5.5
Sequence: AAACGTAACCGGTAAACTAA
Locus tag: BIFANG_01235
Name: hxlP
Funciton: Predicted hexulose permease
Locus tag: BIFANG_01234
Name: usp
Funciton: Predicted sugar phosphate isomerase/epimerase
Locus tag: BIFANG_01233
Name: hxlK
Funciton: Predicted hexulose kinase
Locus tag: BIFANG_01232
Name: hxlA
Funciton: 3-hexulose 6-phosphate formaldehyde-lyase
Locus tag: BIFANG_01231
Name: hxlB
Funciton: Predicted 6-phospho-3-hexuloisomerase
hxlP
Predicted hexulose permease
usp
Predicted sugar phosphate isomerase/epimerase
hxlK
Predicted hexulose kinase
hxlA
3-hexulose 6-phosphate formaldehyde-lyase
hxlB
Predicted 6-phospho-3-hexuloisomerase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD