Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BLA_0143 in Bifidobacterium dentium Bd1

Properties
Regulator type: Transcription factor
TF locus tag: BDP_0129
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BLA_0143 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -110
Score: 6
Sequence: CTACTTAAGCGCTTAATATA
Locus tag: BDP_0134
Name: null
Funciton: alpha-galactosidase
alpha-galactosidase

Position: -98
Score: 6
Sequence: TATATTAAGCGCTTAAGTAG
Locus tag: BDP_0133
Name: SSF53850
Funciton: Periplasmic binding protein-like II superfamily
Locus tag: BDP_0132
Name: PF04854
Funciton: Protein of unknown function, DUF624
SSF53850
Periplasmic binding protein-like II superfamily
PF04854
Protein of unknown function, DUF624

Position: -44
Score: 5.1
Sequence: TTAAGTAATCGCTTAAGTTC
Locus tag: BDP_0129
Name: BLA_0143
Funciton: Transcriptional regulator, LacI family
BLA_0143
Transcriptional regulator, LacI family

Position: -30
Score: 5.7
Sequence: TATCTTAACCGCTTCAGGAA
Locus tag: BDP_0124
Name: null
Funciton: Beta-glucosidase (EC 3.2.1.21)
Beta-glucosidase (EC 3.2.1.21)

Position: -88
Score: 5.7
Sequence: TGCATTAACCGCTTAAGTGA
Locus tag: BDP_1538
Name: null
Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
N-acylglucosamine 2-epimerase (EC 5.1.3.8)

Position: -162
Score: 5.4
Sequence: CAACTTAAGCGCTTGACAAA
Locus tag: BDP_0125
Name: null
Funciton: ABC transport system, sugar-binding component
Locus tag: BDP_0126
Name: null
Funciton: ABC-type sugar transport system, permease component
Locus tag: BDP_0127
Name: null
Funciton: ABC-type sugar transport system, permease component
Locus tag: BDP_0128
Name: bmnA
Funciton: Beta-mannosidase (EC 3.2.1.25)
ABC transport system, sugar-binding component
ABC-type sugar transport system, permease component
ABC-type sugar transport system, permease component
bmnA
Beta-mannosidase (EC 3.2.1.25)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD