Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BLA_0143 in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type: Transcription factor
TF locus tag: BLA_0143
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BLA_0143 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -224
Score: 5.9
Sequence: TATATTAAGCGGTTAAGTCA
Locus tag: BLA_0145
Name: SSF53850
Funciton: Periplasmic binding protein-like II superfamily
Locus tag: BLA_0144
Name: PF04854
Funciton: Protein of unknown function, DUF624
SSF53850
Periplasmic binding protein-like II superfamily
PF04854
Protein of unknown function, DUF624

Position: -199
Score: 5.7
Sequence: CGACTTAAGCGCTTCAGTGA
Locus tag: BLA_0147
Name: null
Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
N-acylglucosamine 2-epimerase (EC 5.1.3.8)

Position: -134
Score: 5.6
Sequence: GAACTTAAGCGCTTGATAAA
Locus tag: BLA_0142
Name: bmnA
Funciton: Beta-mannosidase (EC 3.2.1.25)
bmnA
Beta-mannosidase (EC 3.2.1.25)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD