Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BLA_0143 in Bifidobacterium angulatum DSM 20098

Properties
Regulator type: Transcription factor
TF locus tag: BIFANG_00310
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BLA_0143 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -41
Score: 4.3
Sequence: TGGCTGAAGCGCTTCTTGCA
Locus tag: BIFANG_00310
Name: BLA_0143
Funciton: Transcriptional regulator, LacI family
BLA_0143
Transcriptional regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD