Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RspR in Silicibacter pomeroyi DSS-3

Properties
Regulator type: Transcription factor
TF locus tag: SPO1722
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Rhodobacterales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 5.4
Sequence: CATACTTCCATACTAGTCGG
Locus tag: SPO1723
Name: uxuA
Funciton: Mannonate dehydratase (EC 4.2.1.8)
Locus tag: SPO1724
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
uxuA
Mannonate dehydratase (EC 4.2.1.8)
uxuB
D-mannonate oxidoreductase (EC 1.1.1.57)

Position: -47
Score: 5.4
Sequence: CCGACTAGTATGGAAGTATG
Locus tag: SPO1722
Name: rspR
Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
Locus tag: SPO1721
Name: rspP
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
Locus tag: SPO1720
Name: rspQ
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
Locus tag: SPO1719
Name: rspM
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
rspR
Transcriptional regulator for L-gulonate utilization, GntR family
rspP
L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
rspQ
L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
rspM
L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD