Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RspR in Paracoccus denitrificans PD1222

Properties
Regulator type: Transcription factor
TF locus tag:
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Rhodobacterales
Statistics of regulated genes:
- Genes 9
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 5.8
Sequence: TTTACTAGTATGCAAGTATG
Locus tag: Pden_5067
Name: rspR
Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
Locus tag: Pden_5066
Name: rspP
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
Locus tag: Pden_5065
Name: rspQ
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
Locus tag: Pden_5064
Name: rspM
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
Locus tag: Pden_5063
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: Pden_5062
Name: COG1304
Funciton: L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases
Locus tag: Pden_5061
Name: uxuA
Funciton: Mannonate dehydratase (EC 4.2.1.8)
Locus tag: Pden_5060
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: Pden_5059
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
rspR
Transcriptional regulator for L-gulonate utilization, GntR family
rspP
L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
rspQ
L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
rspM
L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
rspB
L-gulonate dehydrogenase, COG1063 family
COG1304
L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases
uxuA
Mannonate dehydratase (EC 4.2.1.8)
uxuB
D-mannonate oxidoreductase (EC 1.1.1.57)
kdgK
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD