Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RspR in Serratia proteamaculans 568

Properties
Regulator type: Transcription factor
TF locus tag: Spro_3567
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Enterobacteriales
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 5.3
Sequence: CATACTTGTATGGTAGTTAG
Locus tag: Spro_3563
Name: rspA
Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
Locus tag: Spro_3564
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: Spro_3565
Name: rspC
Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family
Locus tag: Spro_3566
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: Spro_3567
Name: rspR
Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
rspA
D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
rspB
L-gulonate dehydrogenase, COG1063 family
rspC
Putative gulonate transporter, MFS superfamily, COG2271 family
rspD
D-mannonate oxidoreductase (EC 1.1.1.57)
rspR
Transcriptional regulator for L-gulonate utilization, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD