Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RspR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type: Transcription factor
TF locus tag: KPN_01589
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Enterobacteriales
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -132
Score: 5.2
Sequence: TCTTCTTGTATGGTAGTTGA
Locus tag: KPN_01587
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
rspD
D-mannonate oxidoreductase (EC 1.1.1.57)

Position: -49
Score: 5.3
Sequence: CATACTTGTATGGTAATAAA
Locus tag: KPN_03621
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: KPN_03622
Name: rspC
Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family
rspB
L-gulonate dehydrogenase, COG1063 family
rspC
Putative gulonate transporter, MFS superfamily, COG2271 family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD