Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RspR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type: Transcription factor
TF locus tag: b1540
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Enterobacteriales
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -70
Score: 5.8
Sequence: TATACTTGTATGGTAGTAGC
Locus tag: b1581
Name: rspA
Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
Locus tag: b1580
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
rspA
D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
rspB
L-gulonate dehydrogenase, COG1063 family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD