Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RspR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type: Transcription factor
TF locus tag: CKO_01570
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Enterobacteriales
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -133
Score: 5.6
Sequence: TACACTTGTATGGTAGTAGA
Locus tag: CKO_03735
Name: uxaC2
Funciton: Uronate isomerase (EC 5.3.1.12)
Locus tag: CKO_03734
Name: COG2211
Funciton: Oligogalacturonide transporter
Locus tag: CKO_03733
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
uxaC2
Uronate isomerase (EC 5.3.1.12)
COG2211
Oligogalacturonide transporter
rspD
D-mannonate oxidoreductase (EC 1.1.1.57)

Position: -70
Score: 5.8
Sequence: TATACTTGTATGGTAGTAGT
Locus tag: CKO_01575
Name: rspA
Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
Locus tag: CKO_01574
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: CKO_01573
Name: rspC
Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family
Locus tag: CKO_01572
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
rspA
D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
rspB
L-gulonate dehydrogenase, COG1063 family
rspC
Putative gulonate transporter, MFS superfamily, COG2271 family
rspD
D-mannonate oxidoreductase (EC 1.1.1.57)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD