Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Mycobacterium abscessus ATCC 19977

Properties
Regulator type: Transcription factor
TF locus tag: MAB_0901c
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Mycobacteriaceae
Statistics of regulated genes:
- Genes 13
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -92
Score: 6.2
Sequence: AATAACCGATCGTTCGGTCGGT
Position: -88
Score: 4.7
Sequence: ACCGATCGTTCGGTCGGTTGTC
Locus tag: MAB_0901c
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family

Position: -48
Score: 4.7
Sequence: GACAACCGACCGAACGATCGGT
Position: -44
Score: 6.2
Sequence: ACCGACCGAACGATCGGTTATT
Locus tag: MAB_0902
Name: paaJ
Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Locus tag: MAB_0903
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: MAB_0904
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: MAB_0905
Name: paaG
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
paaJ
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF
Enoyl-CoA hydratase (EC 4.2.1.17)
paaH
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaG
Enoyl-CoA hydratase (EC 4.2.1.17)

Position: -108
Score: 4.9
Sequence: ACTGACCGTTCGGTCGGCCACA
Position: -35
Score: 5.4
Sequence: ACCGAACGAATGGACGGTTGGT
Locus tag: MAB_0900c
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Locus tag: MAB_0899c
Name: ethD
Funciton: Possible ethyl tert-butyl ether degradation protein EthD
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
ethD
Possible ethyl tert-butyl ether degradation protein EthD

Position: -37
Score: 6.1
Sequence: AATAACCGAACATTCGGTCGGT
Position: -33
Score: 4.5
Sequence: ACCGAACATTCGGTCGGTAATC
Locus tag: MAB_0906
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: MAB_0907
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: MAB_0908
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: MAB_0909
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: MAB_0910
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: MAB_0911
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD