Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CzrA in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type: Transcription factor
TF locus tag: lwe2441
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Regulog: CzrA - Listeriaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -43
Score: 6.8
Sequence: CATATGAGTATATGAACATATA
Locus tag: lwe2441
Name: czrA
Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family
Locus tag: lwe2440
Name: null
Funciton: Hypothetical protein
Locus tag: lwe2439
Name: czcD
Funciton: Cation efflux transporter
Locus tag: lwe2438
Name: csbA
Funciton: Hypothetical protein
czrA
Transcriptional repressor of multiple metal-sensing, ArsR family
Hypothetical protein
czcD
Cation efflux transporter
csbA
Hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD