Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SdaR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type: Transcription factor
TF locus tag: XAC4359
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: SdaR - Xanthomonadales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -102
Score: 6.1
Sequence: ATTTGGGCAGTTGCACAAAA
Locus tag: XAC4361
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: XAC4360
Name: garK
Funciton: Glycerate kinase (EC 2.7.1.31)
Locus tag: XAC4359
Name: sdaR
Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
grtP
D-glycerate transporter, GntP family
garK
Glycerate kinase (EC 2.7.1.31)
sdaR
Glycerate utilization transcriptional regulator SdaR, SdaR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD