Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FixK in Caulobacter sp. K31

Properties
Regulator type: Transcription factor
TF locus tag: Caul_0629, Caul_2457, Caul_2975
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FixK - Caulobacterales
Statistics of regulated genes:
- Genes 23
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 4.3
Sequence: ACGTTGATGTACGTCAAATC
Position: -42
Score: 4.9
Sequence: GCCGTGAGGGATATGAAGGC
Locus tag: Caul_4506
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: Caul_4505
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: Caul_4504
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: Caul_4503
Name: ctaX
Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: Caul_4502
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: Caul_4501
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaD
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
Hypothetical protein in cta-cyo gene cluster
ctaG
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Position: -92
Score: 5.5
Sequence: TCCTTGACACCAATCAAAGC
Locus tag: Caul_0634
Name: cydA
Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: Caul_0635
Name: cydB
Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Locus tag: Caul_0636
Name: cydX
Funciton: CydX protein, presumably involved in maturation of CydAB complex
cydA
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydX
CydX protein, presumably involved in maturation of CydAB complex

Position: -64
Score: 5.2
Sequence: GACTTGACGCGCGTCAAGGT
Locus tag: Caul_3872
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

Position: -69
Score: 4.5
Sequence: GCTTTGACCCAAGTCAATTT
Locus tag: Caul_2437
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Caul_2438
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Caul_2439
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Caul_2440
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Caul_2441
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Caul_2442
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Caul_2443
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Caul_2444
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Position: -77
Score: 4.1
Sequence: CCCTATAGACGCGTCAAGGC
Position: -51
Score: 5.5
Sequence: GCTTTGATTGGTGTCAAGGA
Locus tag: Caul_0633
Name: cydD
Funciton: ATP-binding/permease protein CydD
Locus tag: Caul_0632
Name: cydC
Funciton: ATP-binding/permease protein CydC
Locus tag: Caul_0631
Name: fixL
Funciton: Two-component oxygen-sensor histidine kinase FixL
Locus tag: Caul_0630
Name: fixJ
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
Locus tag: Caul_0629
Name: fixK
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
cydD
ATP-binding/permease protein CydD
cydC
ATP-binding/permease protein CydC
fixL
Two-component oxygen-sensor histidine kinase FixL
fixJ
Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
fixK
Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD