Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FixK in Caulobacter segnis ATCC 21756

Properties
Regulator type: Transcription factor
TF locus tag: Cseg_3612
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FixK - Caulobacterales
Statistics of regulated genes:
- Genes 23
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -92
Score: 5.8
Sequence: TCCTTGATCACGATCAAGGC
Locus tag: Cseg_3605
Name: cydA
Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: Cseg_3604
Name: cydB
Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Locus tag: Cseg_3603
Name: cydX
Funciton: CydX protein, presumably involved in maturation of CydAB complex
cydA
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydX
CydX protein, presumably involved in maturation of CydAB complex

Position: -65
Score: 4.7
Sequence: GGATTGATCCAAATCACGGC
Locus tag: Cseg_1891
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

Position: -45
Score: 4.2
Sequence: ACATTGATCATCGTCAAATC
Position: -12
Score: 4.9
Sequence: GCCGTGAGGGATATGAAGGC
Locus tag: Cseg_0283
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: Cseg_0284
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: Cseg_0285
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: Cseg_0286
Name: ctaX
Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: Cseg_0287
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: Cseg_0288
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaD
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
Hypothetical protein in cta-cyo gene cluster
ctaG
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Position: -75
Score: 5.7
Sequence: GCTTTGAGACAGATCAAAGC
Locus tag: Cseg_1883
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Cseg_1884
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Cseg_1885
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Cseg_1886
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Cseg_1887
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Cseg_1888
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Cseg_1889
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Cseg_1890
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Position: -139
Score: 5.2
Sequence: ACTTTGATCCCGGTCAAAAC
Locus tag: Cseg_3612
Name: fixK
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
fixK
Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family

Position: -64
Score: 4.9
Sequence: GCCTTGACCTGCCTCAAACG
Locus tag: Cseg_3609
Name: fixL
Funciton: Two-component oxygen-sensor histidine kinase FixL
Locus tag: Cseg_3610
Name: fixJ
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
fixL
Two-component oxygen-sensor histidine kinase FixL
fixJ
Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family

Position: -50
Score: 5.8
Sequence: GCCTTGATCGTGATCAAGGA
Locus tag: Cseg_3606
Name: cydD
Funciton: ATP-binding/permease protein CydD
Locus tag: Cseg_3607
Name: cydC
Funciton: ATP-binding/permease protein CydC
cydD
ATP-binding/permease protein CydD
cydC
ATP-binding/permease protein CydC
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD