Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FixK in Caulobacter crescentus CB15

Properties
Regulator type: Transcription factor
TF locus tag: CC0752
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FixK - Caulobacterales
Statistics of regulated genes:
- Genes 14
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -45
Score: 5.6
Sequence: GCCTTGATCGGGCTCAAATC
Position: -12
Score: 4.9
Sequence: GCCGTGAGGGATATGAAGGC
Locus tag: CC3407
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: CC3406
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: CC3405
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: CC3404
Name: ctaX
Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: CC3403
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: CC3402
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaD
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
Hypothetical protein in cta-cyo gene cluster
ctaG
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Position: -93
Score: 6.2
Sequence: GCCTTGATCCGGATCAAGGA
Locus tag: CC0762
Name: cydA
Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: CC0763
Name: cydB
Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydA
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)

Position: -50
Score: 6.2
Sequence: TCCTTGATCCGGATCAAGGC
Locus tag: CC0761
Name: cydD
Funciton: ATP-binding/permease protein CydD
Locus tag: CC0760
Name: cydC
Funciton: ATP-binding/permease protein CydC
cydD
ATP-binding/permease protein CydD
cydC
ATP-binding/permease protein CydC

Position: -37
Score: 5
Sequence: GCCTTGACCTGGCTCAAACG
Locus tag: CC0759
Name: fixL
Funciton: Two-component oxygen-sensor histidine kinase FixL
Locus tag: CC0758
Name: fixJ
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
fixL
Two-component oxygen-sensor histidine kinase FixL
fixJ
Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family

Position: -73
Score: 5.8
Sequence: GCTTTGATGCGTGTCAAAGC
Locus tag: CC1401
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Position: -143
Score: 5.2
Sequence: GCCTTGATCGGCGTCAAAAT
Locus tag: CC0752
Name: fixK
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
fixK
Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD