Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FnrN in Sulfitobacter sp. EE-36

Properties
Regulator type: Transcription factor
TF locus tag: EE36_11304
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 5.6
Sequence: TGTTTGATGCAGATCAAAGC
Locus tag: EE36_02218
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: EE36_02213
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: EE36_02208
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: EE36_02203
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Position: -72
Score: 5.7
Sequence: CATTTGATCTAGATCAAGGC
Locus tag: EE36_02238
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: EE36_02233
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: EE36_02228
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: EE36_02223
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD