Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FnrN in Silicibacter pomeroyi DSS-3

Properties
Regulator type: Transcription factor
TF locus tag: SPO3531
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes 19
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -32
Score: 5.4
Sequence: ACCTTGACTCAGATCAAGTA
Locus tag: SPO3531
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family

Position: -98
Score: 5.7
Sequence: GCTTTGATCTGCATCAAGAC
Locus tag: SPO3527
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA
Predicted universal stress protein UspA

Position: -146
Score: 5.1
Sequence: TAATTGACCCAAGTCAAGGC
Locus tag: SPO2596
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA
5-aminolevulinate synthase (EC 2.3.1.37)

Position: -80
Score: 5.4
Sequence: TTTTTGACCCATATCAAAGT
Locus tag: SPO3522
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SPO3521
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SPO3520
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SPO3519
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Position: -110
Score: 5.7
Sequence: GTCTTGATGCAGATCAAAGC
Locus tag: SPO3526
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: SPO3525
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: SPO3524
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: SPO3523
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Position: -162
Score: 5.6
Sequence: TGTTTGATCCAGATCAAAAA
Locus tag: SPO3076
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: SPO3075
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: SPO3074
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: SPO3073
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaG
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Position: -96
Score: 5.5
Sequence: CGCTTGATCCATATCAAAGT
Locus tag: SPO0330
Name: ccpR
Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
ccpR
Cytochrome c551 peroxidase (EC 1.11.1.5)

Position: -75
Score: 5.2
Sequence: ATCTTGATCCAGATCAGGGA
Locus tag: SPO2792
Name: ompW
Funciton: Outer membrane protein W precursor
ompW
Outer membrane protein W precursor

Position: -52
Score: 5.4
Sequence: TACTTGATCTGAGTCAAGGT
Locus tag: SPO3532
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

Position: -120
Score: 5.6
Sequence: ATCTTGATCCAGATCAAACT
Locus tag: SPO1383
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD