Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FnrN in Roseobacter sp. MED193

Properties
Regulator type: Transcription factor
TF locus tag: MED193_11238
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes 17
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -114
Score: 5.5
Sequence: GCATTGATCTGCATCAAGAC
Locus tag: MED193_11233
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA
Predicted universal stress protein UspA

Position: -162
Score: 5.4
Sequence: TATTTGACCTGTATCAAAGT
Locus tag: MED193_21064
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA
5-aminolevulinate synthase (EC 2.3.1.37)

Position: -178
Score: 5.4
Sequence: TTTTTGATCTAAATCAAGAA
Locus tag: MED193_08963
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: MED193_08958
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: MED193_08953
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: MED193_08948
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: MED193_08943
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
Hypothetical protein in cta gene cluster
ctaG
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Position: -180
Score: 5.4
Sequence: TTTTTGATCCACGTCAAAGA
Locus tag: MED193_11193
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: MED193_11188
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: MED193_11183
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: MED193_11178
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Position: -93
Score: 5.5
Sequence: GTCTTGATGCAGATCAATGC
Locus tag: MED193_11228
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: MED193_11223
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: MED193_11218
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: MED193_11213
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Position: -122
Score: 5.6
Sequence: ATCTTGATCCAGATCAAACT
Locus tag: MED193_08728
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)

Position: -29
Score: 5.3
Sequence: ACTTTGACTTGGATCAAACG
Locus tag: MED193_11238
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD