Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FnrN in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type: Transcription factor
TF locus tag: RSP_0698
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes 20
- Operons 9
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -87
Score: 5.2
Sequence: GATTTGATCCTTATCAAGGC
Locus tag: RSP_2984
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA
5-aminolevulinate synthase (EC 2.3.1.37)

Position: -111
Score: 5.4
Sequence: GCCTTGATCCATGTCAATGG
Position: -79
Score: 5.1
Sequence: TACTTGATCCTCATCAAGGA
Locus tag: RSP_0697
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA
Predicted universal stress protein UspA

Position: -136
Score: 5.1
Sequence: TCCTTGATGAGGATCAAGTA
Position: -104
Score: 5.4
Sequence: CCATTGACATGGATCAAGGC
Locus tag: RSP_0696
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: RSP_0695
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: RSP_0694
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: RSP_0693
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: RSP_0692
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RSP_0691
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RSP_0690
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: RSP_0689
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Position: -31
Score: 5.5
Sequence: GCTTTGATTCAGATCAAGCG
Locus tag: RSP_0698
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family

Position: -81
Score: 5.2
Sequence: GAATTGATCTAAGTCAAAGG
Locus tag: RSP_2395
Name: ccpR
Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
ccpR
Cytochrome c551 peroxidase (EC 1.11.1.5)

Position: -69
Score: 5.4
Sequence: CCATTGACGCAGATCAAGGC
Locus tag: RSP_2507
Name: ompW
Funciton: Outer membrane protein W precursor
ompW
Outer membrane protein W precursor

Position: -51
Score: 5.5
Sequence: CGCTTGATCTGAATCAAAGC
Locus tag: RSP_0699
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

Position: -127
Score: 5.6
Sequence: TTATTGATCCAGATCAAAGT
Locus tag: RSP_1877
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)

Position: -161
Score: 5.5
Sequence: TCCTTGATTCAGATCAAATG
Locus tag: RSP_1826
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: RSP_1827
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: RSP_6021
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: RSP_1828
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: RSP_1829
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
Hypothetical protein in cta gene cluster
ctaG
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD