Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FnrN in Oceanicola granulosus HTCC2516

Properties
Regulator type: Transcription factor
TF locus tag: OG2516_17530
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 5.9
Sequence: GCCTTGATCTGGATCAAGGT
Locus tag: OG2516_17525
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA
Predicted universal stress protein UspA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD