Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FnrN in Loktanella vestfoldensis SKA53

Properties
Regulator type: Transcription factor
TF locus tag: SKA53_08756
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes 10
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -136
Score: 5.1
Sequence: TCGTTGATGTGGATCAACCC
Position: -114
Score: 5.3
Sequence: CGTTTGACATGGATCAATGC
Locus tag: SKA53_08751
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA
Predicted universal stress protein UspA

Position: -167
Score: 4.9
Sequence: TTATTGATCCAGATCATGGT
Locus tag: SKA53_02751
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA
5-aminolevulinate synthase (EC 2.3.1.37)

Position: -177
Score: 5.6
Sequence: TGCTTGATCCACATCAAGGA
Locus tag: SKA53_08641
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SKA53_08646
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SKA53_08651
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SKA53_08656
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Position: -105
Score: 5.3
Sequence: GCATTGATCCATGTCAAACG
Position: -83
Score: 5.1
Sequence: GGGTTGATCCACATCAACGA
Locus tag: SKA53_08741
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: SKA53_08736
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: SKA53_08731
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: SKA53_08726
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoN
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD