Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GulR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC3246
Regulator family: LysR
Regulation mode:
Biological process: Galactarate utilization; Glucarate utilization
Effector:
Regulog: GulR - Xanthomonadales
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -101
Score: 5.6
Sequence: ATCGATTCAATTTATGTATCAAA
Locus tag: XCC3245
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: XCC3244
Name: kgsD
Funciton: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
Locus tag: XCC3243
Name: gudP
Funciton: D-galactarate permease / D-glucarate permease
Locus tag: XCC3242
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
Locus tag: XCC3241
Name: omp
Funciton: Outer membrane porin protein 32 precursor
Locus tag: XCC3240
Name: garD
Funciton: D-galactarate dehydratase (EC 4.2.1.42)
kdgD
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
gudP
D-galactarate permease / D-glucarate permease
gudD
Glucarate dehydratase (EC 4.2.1.40)
omp
Outer membrane porin protein 32 precursor
garD
D-galactarate dehydratase (EC 4.2.1.42)

Position: -219
Score: 5.6
Sequence: TTTGATACATAAATTGAATCGAT
Locus tag: XCC3246
Name: gulR
Funciton: Predicted galactarate/glucarate utilization regulator, LysR family
gulR
Predicted galactarate/glucarate utilization regulator, LysR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD