Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AmtR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_73671
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Regulog: AmtR - Streptomycetaceae
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -78
Score: 7.9
Sequence: AATTTCTGTCGCCCGACAGGAATT
Locus tag: SCAB_73751
Name: uctT
Funciton: Urea carboxylase-related transporter, Amino acid permease family
uctT
Urea carboxylase-related transporter, Amino acid permease family

Position: -126
Score: 7.9
Sequence: AATTTCTGTCGCGCGACAGAAATC
Locus tag: SCAB_73661
Name: amt1
Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Locus tag: SCAB_73651
Name: amt2
Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Locus tag: SCAB_73641
Name: ucaA
Funciton: Urea carboxylase (EC 6.3.4.6)
Locus tag: SCAB_73631
Name: ucaB
Funciton: Allophanate hydrolase (EC 3.5.1.54)
amt1
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
amt2
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
ucaA
Urea carboxylase (EC 6.3.4.6)
ucaB
Allophanate hydrolase (EC 3.5.1.54)

Position: -156
Score: 7.9
Sequence: GATTTCTGTCGCGCGACAGAAATT
Locus tag: SCAB_73671
Name: amtR
Funciton: Transcriptional regulator of urea utilization, TetR family
amtR
Transcriptional regulator of urea utilization, TetR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD