Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AmtR in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_6701
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Regulog: AmtR - Streptomycetaceae
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 7.7
Sequence: AATTTCTGTCGGGCGACAGAAATC
Locus tag: SAV_6700
Name: amt1
Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Locus tag: SAV_6699
Name: amt2
Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Locus tag: SAV_6698
Name: ucaA
Funciton: Urea carboxylase (EC 6.3.4.6)
Locus tag: SAV_6697
Name: ucaB
Funciton: Allophanate hydrolase (EC 3.5.1.54)
amt1
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
amt2
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
ucaA
Urea carboxylase (EC 6.3.4.6)
ucaB
Allophanate hydrolase (EC 3.5.1.54)

Position: -35
Score: 7.7
Sequence: AATTTCTGTCGCCCGACAGGAACT
Locus tag: SAV_6709
Name: uctT
Funciton: Urea carboxylase-related transporter, Amino acid permease family
uctT
Urea carboxylase-related transporter, Amino acid permease family

Position: -155
Score: 7.9
Sequence: GATTTCTGTCGCCCGACAGAAATT
Locus tag: SAV_6701
Name: amtR
Funciton: Transcriptional regulator of urea utilization, TetR family
amtR
Transcriptional regulator of urea utilization, TetR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD