Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_45331
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Streptomycetaceae
Statistics of regulated genes:
- Genes 12
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 5.8
Sequence: AGTAACCGAACGATCGGTCGGG
Locus tag: SCAB_45341
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: SCAB_45331
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family

Position: -155
Score: 5.8
Sequence: CCCGACCGATCGTTCGGTTACT
Locus tag: SCAB_45351
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Position: -184
Score: 5.2
Sequence: CCCAACCGACCATTCGTTCGGG
Position: -52
Score: 5.5
Sequence: AGCAACCGAATGGTCGGTCGGC
Locus tag: SCAB_82261
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)

Position: -77
Score: 5.9
Sequence: AACGACCGAACAATCGGTAGGT
Locus tag: SCAB_45311
Name: bkdA
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Locus tag: SCAB_45301
Name: bkdB
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Locus tag: SCAB_45291
Name: bkdC
Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
bkdA
Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
bkdB
Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
bkdC
Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)

Position: -166
Score: 5.5
Sequence: GCCGACCGACCATTCGGTTGCT
Position: -34
Score: 5.2
Sequence: CCCGAACGAATGGTCGGTTGGG
Locus tag: SCAB_82281
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: SCAB_82291
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: SCAB_82301
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: SCAB_82311
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: SCAB_82321
Name: paaE
Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Phenylacetate-CoA oxygenase, PaaE subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD