Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO3833
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Streptomycetaceae
Statistics of regulated genes:
- Genes 13
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 5.8
Sequence: AGTAACCGAACGATCGGTCGGG
Locus tag: SCO3834
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: SCO3833
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family

Position: -152
Score: 5.5
Sequence: CCCAACCGACCATTCGTTCGGT
Position: -29
Score: 5.6
Sequence: GCTAACCGAATGGTCGGTCGGG
Locus tag: SCO7470
Name: paaI
Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
Locus tag: SCO7469
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaI
Phenylacetic acid degradation protein PaaI, thioesterase
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)

Position: -157
Score: 5.6
Sequence: CCCGACCGACCATTCGGTTAGC
Position: -34
Score: 5.5
Sequence: ACCGAACGAATGGTCGGTTGGG
Locus tag: SCO7471
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: SCO7472
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: SCO7473
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: SCO7474
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: SCO7475
Name: paaE
Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Phenylacetate-CoA oxygenase, PaaE subunit

Position: -106
Score: 5.8
Sequence: CCCGACCGATCGTTCGGTTACT
Locus tag: SCO3835
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Position: -78
Score: 5.6
Sequence: GACGACCGAACAATCGGTAGGT
Locus tag: SCO3831
Name: bkdA
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Locus tag: SCO3830
Name: bkdB
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Locus tag: SCO3829
Name: bkdC
Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
bkdA
Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
bkdB
Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
bkdC
Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD