Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO2508
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Streptomycetaceae
Statistics of regulated genes:
- Genes 16
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5
Sequence: TGTTGACAACGGTTTCCATAT
Position: -17
Score: 4.6
Sequence: TGTTGAAAATGAGTGTCATGA
Locus tag: SCO2505
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCO2506
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SCO2507
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCO2508
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -56
Score: 5
Sequence: ACATGAACATCGTTTTCATGT
Locus tag: SCO0436
Name: rpmF2
Funciton: LSU ribosomal protein L32p
rpmF2
LSU ribosomal protein L32p

Position: -62
Score: 5.9
Sequence: TACTGAAAATGAATTCCATTA
Locus tag: SCO3429
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: SCO3430
Name: rpsN2
Funciton: SSU ribosomal protein S14p
Locus tag: SCO3431
Name: SC03431
Funciton: possible membrane protein
rpmB2
LSU ribosomal protein L28p
rpsN2
SSU ribosomal protein S14p
SC03431
possible membrane protein

Position: -31
Score: 5.9
Sequence: TAATGGAATTCATTTTCAGTA
Locus tag: SCO3428
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: SCO3427
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: SCO3426
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: SCO3425
Name: rpsR2
Funciton: SSU ribosomal protein S18p
rpmG2
LSU ribosomal protein L33p
rpmE2
LSU ribosomal protein L31p
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpsR2
SSU ribosomal protein S18p

Position: -34
Score: 4.9
Sequence: TGTTGAACATGATTTTCATTG
Locus tag: SCO0475
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCO0474
Name: SCO0474
Funciton: WD40/YVTN repeat-like-containing domain
Locus tag: SCO0473
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCO0472
Name: SCO0472
Funciton: WD40/YVTN repeat-like-containing domain
znuB2
Zinc ABC transporter, inner membrane permease protein ZnuB
SCO0474
WD40/YVTN repeat-like-containing domain
znuA2
Zinc ABC transporter, periplasmic-binding protein ZnuA
SCO0472
WD40/YVTN repeat-like-containing domain
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD