Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type: Transcription factor
TF locus tag: SGR_5016
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Streptomycetaceae
Statistics of regulated genes:
- Genes 10
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5
Sequence: TGTTGACAATCGTTTCCACTT
Position: -17
Score: 4.6
Sequence: AGTTGAAAATGAGTGTCATGA
Locus tag: SGR_5019
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SGR_5018
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SGR_5017
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SGR_5016
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -58
Score: 5.6
Sequence: ATATGGCAATGGTTTCCATTT
Locus tag: SGR_545
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: SGR_544
Name: rpsN2
Funciton: SSU ribosomal protein S14p
rpmB2
LSU ribosomal protein L28p
rpsN2
SSU ribosomal protein S14p

Position: -31
Score: 5.6
Sequence: AAATGGAAACCATTGCCATAT
Locus tag: SGR_546
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: SGR_547
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: SGR_548
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: SGR_549
Name: rpsR2
Funciton: SSU ribosomal protein S18p
rpmG2
LSU ribosomal protein L33p
rpmE2
LSU ribosomal protein L31p
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpsR2
SSU ribosomal protein S18p
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD