Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_61951
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Streptomycetaceae
Statistics of regulated genes:
- Genes 12
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5
Sequence: TGTTGACAATCGTTTCCAGAT
Position: -17
Score: 5.1
Sequence: AGATGAAAATGACTGTCATGA
Locus tag: SCAB_61981
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCAB_61971
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SCAB_61961
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCAB_61951
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -64
Score: 5.1
Sequence: TAATGGGATCCATTTTCATGT
Locus tag: SCAB_41531
Name: rpmF2
Funciton: LSU ribosomal protein L32p
rpmF2
LSU ribosomal protein L32p

Position: -31
Score: 5.9
Sequence: AAATGGAATTCATTTTCAGTA
Locus tag: SCAB_40001
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: SCAB_39991
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: SCAB_39981
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: SCAB_39971
Name: rpsR2
Funciton: SSU ribosomal protein S18p
rpmG2
LSU ribosomal protein L33p
rpmE2
LSU ribosomal protein L31p
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpsR2
SSU ribosomal protein S18p

Position: -66
Score: 5.9
Sequence: TACTGAAAATGAATTCCATTT
Locus tag: SCAB_40011
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: SCAB_40021
Name: rpsN2
Funciton: SSU ribosomal protein S14p
Locus tag: SCAB_40031
Name: SC03431
Funciton: possible membrane protein
rpmB2
LSU ribosomal protein L28p
rpsN2
SSU ribosomal protein S14p
SC03431
possible membrane protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD