Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Rhodococcus sp. RHA1

Properties
Regulator type: Transcription factor
TF locus tag: RHA1_ro03367
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Regulog: ArsR - Nocardiaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -13
Score: 7.1
Sequence: TCAATATCGACGCATGTCGA
Locus tag: RHA1_ro03367
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RHA1_ro03368
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RHA1_ro03369
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR
Arsenical resistance operon repressor, ArsR family
arsB
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD